Accueil
Index

b3.gif (232 octets)

 

 

Les gènes

 

 

Le gène est l'unité fonctionnelle de base de l'information génétique.

C'est aussi un fragment de la molécule d' A.D.N.

Le génome de l'être humain contient environ 30 000 gènes.

Une grande partie de l' A.D.N. n'est pas codante c'est à dire qu'elle ne contient aucun gène.

L'ensemble des gènes d'un individu constitue son génotype. 

Les caractères " visibles " déterminés par les gènes constituent son phénotype.

Il existe des gènes de structure et des gènes de régulation.

Les gènes de structure contiennent l'information utilisable par la cellule pour fabriquer ses protéines.

Dans une première étape nommée transcription, qui se déroule dans le noyau, les cellules synthétisent une copie du gène de structure sous forme d' A.R.N.m.

Cet A.R.N.m. passe ensuite dans le cytoplasme où il va subir un processus nommé traduction au cours duquel il va être traduit en protéines.

La séquence des nucléotides du gène va déterminer la séquence en nucléotides de l'A.R.N. qui va déterminer la séquence des acides aminés de la protéine. 

A chaque triplet de trois bases successives ou codon va correspondre un acide aminé. 

Cette correspondance est déterminée par le code génétique .

Dans les organismes diploïdes (2n chromosomes), les gènes codant pour un caractère sont en deux exemplaires qui peuvent être différent (gènes allèles)

Si un seul exemplaire du gène est suffisant pour que le caractère s'exprime ce gène est dit dominant.

S' il doit être présent en deux exemplaires pour que le caractère s'exprime il est dit récessif.

Les gènes de régulation  vont permettrent de réguler la transcription des gènes de structure et donc la synthèse de protéine associée. 

On appelle opéron l'ensemble gène(s) de structure + gène de régulation associé.

 

La modification d'une ou de plusieurs bases d'un gène est une mutation. 

Ces mutations accumulées sur des milliards d'années sont un des moteurs de l'évolution (l'autre étant la sélection naturelle).

Si l' expression d'un gène agit sur plusieurs caractères, ce gène est pléiotrope.

Il faut souvent l'expression simultanée de plusieurs gènes  pour aboutir à un caractère phénotypique.

On peut actuellement réaliser des synthèses de portion de gène artificiellement avec des machines automatisées.

On peut déterminer la séquence des gènes à l'aide de séquenceur d'A.D.N.

Le transfert de gènes dans différentes cellules ou organismes s'appelle la transgénèse. 

Les organismes ou cellules modifiés par insertion d'un ou plusieurs gènes se nomment des transgènes. 

L'ensemble des savoirs et des techniques nécessaires à la transgénèse constitue le domaine du génie génétique. 

Il existe aussi dans l'A.D.N  des gènes répétés en un très grand nombre d'exemplaires (plusieurs milliers) qui ne sont pas traduit en protéines (gènes non codants) ainsi que des génes sauteurs comme les transposons qui se déplacent de manière aléatoire et saltatoire le long du génome. 

Ils favorisent les mutations aux endroits où ils s'insèrent (donc à long terme ils favorisent aussi l'évolution des gènes).

 
 

Ci - dessous séquence d'un gène (cholinergic receptor, nicotinic, alpha polypeptide 4 )

 

atggagctagggggccccggagcgccgcggctgctgccgccgctgctgctgcttctggggaccggcctcctgcgcgccagcagccatgtggagacccgggcccacgccgaggagcggctcctgaagaaactcttctccggttacaacaagtggtcccgacccgtggccaacatctcggac gtggtcctcgtccgcttcggcctgtccatcgctcagctcattgacgtggatgagaagaac cagatgatgaccacgaacgtatgggtgaagcaggagtggcacgactacaagctgcgctgg gacccagctgactatgagaatgtcacctccatccgcatcccctccgagctcatctggcgg ccggacatcgtcctctacaacaatgctgacggggacttcgcggtcacccacctgaccaag gcccacctgttccatgacgggcgggtgcagtggactcccccggccatttacaagagctcc tgcagcatcgacgtcaccttcttccccttcgaccagcagaactgcaccatgaaattcggc tcctggacctacgacaaggccaagatcgacctggtgaacatgcacagccgcgtggaccag ctggacttctgggagagtggcgagtgggtcatcgtggacgccgtgggcacctacaacacc aggaagtacgagtgctgcgccgagatctacccggacatcacctatgccttcgtcatccgg cggctgccgctcttctacaccatcaacctcatcatcccctgcctgctcatctcctgcctc accgtgctggtcttctacctgccctccgagtgtggcgagaagatcacgctgtgcatctcc gtgctgctgtcgctcaccgtcttcctgctgctcatcaccgagatcatcccgtccacctca ctggtcatcccactcatcggcgagtacctgctgttcaccatgatcttcgtcaccctgtcc atcgtcatcacggtcttcgtgctcaacgtgcaccaccgctcgccacgcacgcacaccatg cccacctgggtacgcagggtcttcctggacatcgtgccacgcctgctcctcatgaagcgg ccgtccgtggtcaaggacaattgccggcggctcatcgagtccatgcataagatggccagtgccccgcgcttctggcccgagccagaaggggagccccctgccacgagcggcacccagagc ctgcaccctccctcaccgtccttctgcgtccccctggatgtgccggctgagcctgggcct tcctgcaagtcaccctccgaccagctccctcctcagcagcccctggaagctgagaaagccagcccccacccctcgcctggaccctgccgcccgccccacggcacccaggcaccagggctggccaaagccaggtccctcagcgtccagcacatgtccagccctggcgaagcggtggaaggc ggcgtccggtgccggtctcggagcatccagtactgtgttccccgagacgatgccgccccc gaggcagatggccaggctgccggcgccctggcctctcgcaacacccactcggctgagctc ccacccccagaccagccctctccgtgcaaatgcacatgcaagaaggagccctcttcggtg tccccgagcgccacggtcaagacccgcagcaccaaagcgccgcccccgcacctgcccctg tcgccggccctgacccgggcggtggagggcgtccagtacattgcagaccacctgaaggccgaagacacagacttctcggtgaaggaggactggaagtacgtggccatggtcatcgaccgc atcttcctctggatgttcatcatcgtctgcctgctggggacggtgggcctcttcctgccg ccctggctggctggcatgatctag

Pour consulter sa fiche technique cliquez ici

 

 

b3.gif (232 octets)